Mp15-3'-1F, Mp15-DF Primer Detail MGI Mouse MGI:1330485

About Help FAQ

Mp15-3'-1F, Mp15-DF Primer Detail

Name

Mp15-3'-1F, Mp15-DF
Primer 1 Sequence

AGGTATCTGCACGCTGCCAGTGGAGAT
Primer 2 Sequence

CCATAACTCCAGTTTCAAGGAG
ID

MGI:1330485

D4Pel1

DNA segment, Chr 4, Pellicer 1

J:46281 Malumbres M, et al., Mamm Genome. 1998 Mar;9(3):183-5

Gene	Allele	Fragments	Strains
D4Pel1	b	0.196kb	C57BL/6J
	c	~0.21kb	CZECHII
	f	~0.2kb	MOLF/EiJ
	l	~0.182kb	BALB/cJ
	m	~0.190kb	M. m. musculus
	r	0.172kb	CAST/EiJ, RF/J
	s	~0.178kb	SPRET/EiJ

J:46281 Malumbres M, et al., An AC-repeat adjacent to mouse Cdkn2B allows the detection of specific allelic losses in the p15INK4b and p16INK4a tumor suppressor genes. Mamm Genome. 1998 Mar;9(3):183-5

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/05/2024 MGI 6.24