YA2R3, YA2R9 Primer Detail MGI Mouse MGI:1330730

About Help FAQ

YA2R3, YA2R9 Primer Detail

Name

YA2R3, YA2R9
Primer 1 Sequence

AGAGTCTCCACTGGTATATG
Primer 2 Sequence

TGCACACATGTATGTAGAAACAGG
ID

MGI:1330730

DXUsc2

DNA segment, Chr X, University of Southern California 2

J:52077 Korobova O, et al., Genomics. 1998 Dec 15;54(3):556-9

Endonuclease	Gene	Allele	Fragments	Strains
	DXUsc2	c	not given	C3H/HeSnJ
	DXUsc2	d	not given	CAST/EiJ

J:52077 Korobova O, et al., Patchy fur, a mouse coat mutation associated with X-Y nondisjunction, maps to the pseudoautosomal boundary region. Genomics. 1998 Dec 15;54(3):556-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24