About   Help   FAQ
Exon2-pA, Exon2-pB Primer Detail
Primers
  • Name
    Exon2-pA, Exon2-pB
  • Primer 1 Sequence
    GTGATGATGATGGGCAACGTTCA
  • Primer 2 Sequence
    GGGCGTGCTTGAGCTGAAGCTA
  • ID
    MGI:1340219
  • Region Covered
    exon 2
Genes
Cdkn2a cyclin dependent kinase inhibitor 2A
Polymorphisms
J:46172 Zhang S, et al., Proc Natl Acad Sci U S A. 1998 Mar 3;95(5):2429-34
Endonuclease Gene Allele Fragments Strains
BsaAI Cdkn2a b larger ABP/LeJ, BALB/cAnPt, BALB/cJ, M. m. brevirostris, WS
d smaller 129X1/SvJ, A/J, AKR, C57BL/10, CBA/N, DBA/2N, M. booduga, M. gradsko, M. platythrix, M. spretus, NZB/BlNJ, O20/A, P/J, SENCARA, STS/A
References
J:46172 Zhang S, et al., Cdkn2a, the cyclin-dependent kinase inhibitor encoding p16INK4a and p19ARF, is a candidate for the plasmacytoma susceptibility locus, Pctr1. Proc Natl Acad Sci U S A. 1998 Mar 3;95(5):2429-34

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory