D4Mcg5-F, D4Mcg5-R Primer Detail MGI Mouse MGI:1342761

About Help FAQ

D4Mcg5-F, D4Mcg5-R Primer Detail

Name

D4Mcg5-F, D4Mcg5-R
Primer 1 Sequence

GGGAGGATGTAAAGCTTGAT
Primer 2 Sequence

CCAACATCCTCTTACCTCCA
ID

MGI:1342761
Product Size

141bp

D4Mcg5

DNA segment, Chr 4, McGill University 5

J:53343 Qureshi ST, et al., J Exp Med. 1999 Feb 15;189(4):615-25

Notes: These primers were used in SSLP analysis.

Gene	Allele	Fragments	Strains
D4Mcg5	b	larger	C57BL/6J, DBA/2J
	d	small	M. spretus
	h	largest	C3H/HeJ

J:53343 Qureshi ST, et al., Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4) [see comments]. J Exp Med. 1999 Feb 15;189(4):615-25

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13