primer 5, primer 6 Primer Detail MGI Mouse MGI:138

primer 5, primer 6 Primer Detail

Name

primer 5, primer 6
Primer 1 Sequence

CCTTCAATGGATCCCAGTCCAAGGAGGAGG
Primer 2 Sequence

GTTCTAGACTCAAGCTTCATCTGTGTG
ID

MGI:138
Product Size

888bp

Vwf

Von Willebrand factor

J:12631 Barrow LL, et al., Mamm Genome. 1993;4(6):343-5

Endonuclease	Gene	Allele	Fragments	Strains
	Vwf	b	~590bp	C57BL/6J
	Vwf	s	~400bp	SPRET/EiJ

J:18453 Nichols WC, et al., Blood. 1994 Jun 1;83(11):3225-31

Notes: PCR amplified fragment was digested with RsaI, fractionated on a 4% agarose gel, and visualized after staining with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
RsaI	Vwf	a	426,214,127,99,22bp	RIIIS/J
RsaI	Vwf	b	240,214,186,127,99,22bp	PWK/PhJ

J:12631 Barrow LL, et al., Conserved linkage of neurotrophin-3 and von Willebrand factor on mouse chromosome 6. Mamm Genome. 1993;4(6):343-5

J:18453 Nichols WC, et al., von Willebrand disease in the RIIIS/J mouse is caused by a defect outside of the von Willebrand factor gene [published erratum appears in Blood 1995 Sep 15;86(6):2461]. Blood. 1994 Jun 1;83(11):3225-31

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24