About   Help   FAQ
DXMit1-pA, DXMit1-pB Primer Detail
Primers
  • Name
    DXMit1-pA, DXMit1-pB
  • Primer 1 Sequence
    CAGCAAGCAACCGAGGAAGACATCC
  • Primer 2 Sequence
    CTAGCCAGGATGCTAATCACCCTGC
  • ID
    MGI:146
  • Other IDs
    DXMit1-pA (BROAD)
    DXMit1-pB (BROAD)
Genes
DXMit1.2 DNA segment, Chr X, Massachusetts Institute of Technology 1.2
Polymorphisms
J:4132 Angel TA, et al., Mamm Genome. 1993;4(3):171-6
Endonuclease Gene Allele Fragments Strains
DXMit1.2 b 110.0bp C57BL/6J-Aw-J/J
c 118.0bp M. m. castaneus
h 96.0bp C3H
s 106.0bp M. spretus
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit1.2 b 0.97kb B10.D2-H2d, C57BL/6
c 0.84kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
References
J:4132 Angel TA, et al., Genetic mapping of the X-linked dominant mutations striated (Str) and bare patches (Bpa) to a 600-kb region of the mouse X chromosome: implications for mapping human disorders in Xq28. Mamm Genome. 1993;4(3):171-6
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory