33A, 33B Primer Detail MGI Mouse MGI:160

33A, 33B Primer Detail

Name

33A, 33B
Primer 1 Sequence

CCTCCCTATTTTTTCCTGTCATTTGTGTAC
Primer 2 Sequence

TGGAACCTATCATTCTTGTAACCCAAGTCT
ID

MGI:160
Product Size

153bp

DXPas28

DNA segment, Chr X, Pasteur Institute 28

J:14461 Simmler MC, et al., Mamm Genome. 1993 Sep;4(9):523-30

Notes: Genomic DNA from YAC PA-2 was amplified by PCR, electrophoresed on a 6% polyacrylamide denaturing gel and analyzed using autoradiography using a radiolabeled oligo (GT)>10< probe.

Gene	Allele	Fragments	Strains
DXPas28	a	not given	3H1, 101, 129S2/SvPas, C3H/HePas, C57L/J, CBA/Pas
	b	not given	AKR/Pas, C57BL/6Pas, C57BL/10J, C57BR/cdJ, DBA/1J, DBA/2J, JU/Ct, WLA, WMP
	c	not given	C3H-Pgk1^a, M. spicilegus, MAI
	d	not given	SEG/Pas

J:14461 Simmler MC, et al., Mapping the murine Xce locus with (CA)n repeats. Mamm Genome. 1993 Sep;4(9):523-30

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24