About   Help   FAQ
Primer 1, Primer 2 Primer Detail
Primers
  • Name
    Primer 1, Primer 2
  • Primer 1 Sequence
    GGACAGAGAAGAAATGGGTTTC
  • Primer 2 Sequence
    ATCTGGGGCCAATCAGGAGGG
  • ID
    MGI:170
  • Product Size
    103bp
Genes
Tnf tumor necrosis factor
Polymorphisms
J:10553 Jongeneel CV, et al., J Exp Med. 1990 Jun 1;171(6):2141-6
Endonuclease Gene Allele Fragments Strains
Tnf b 103.0bp C57BL/6, NOD, SJL/J
c <<<103.0bp BALB/c, DBA/2, NZB, PL
d <<103.0bp C3H, MRL-Faslpr
n <103.0bp NZW
J:16088 Ikegami H, et al., Biochem Biophys Res Commun. 1993 Apr 30;192(2):677-82
Endonuclease Gene Allele Fragments Strains
Tnf a not given CTS/Shi
b not given C57BL/6J, NOD/Shi, NON/Shi
c not given BALB/c
d not given C3H/He
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
Tnf n 103bp NOD/Shi, NON/Shi
t 120bp CTS/Shi
References
J:10553 Jongeneel CV, et al., A polymorphic microsatellite in the tumor necrosis factor alpha promoter identifies an allele unique to the NZW mouse strain. J Exp Med. 1990 Jun 1;171(6):2141-6
J:16088 Ikegami H, et al., MHC-linked diabetogenic gene of the NOD mouse: molecular mapping of the 3' boundary of the diabetogenic region. Biochem Biophys Res Commun. 1993 Apr 30;192(2):677-82
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory