DXImx8-pA, DXImx8-pB Primer Detail MGI Mouse MGI:1859795

About Help FAQ

DXImx8-pA, DXImx8-pB Primer Detail

Name

DXImx8-pA, DXImx8-pB
Primer 1 Sequence

AGAAACCCTGTCTCGGGG
Primer 2 Sequence

TGTTCTCTCCCCTCATCAACAC
ID

MGI:1859795

DXImx8

DNA segment, Chr X, Immunex 8

J:62168 Means GD, et al., Genomics. 2000 May 1;65(3):213-23

Endonuclease	Gene	Allele	Fragments	Strains
	DXImx8	b	0.225kb	C57BL/6NTac
	DXImx8	s	0.221kb	SF

J:62168 Means GD, et al., A transcript map of a 2-Mb BAC contig in the proximal portion of the mouse X chromosome and regional mapping of the scurfy mutation. Genomics. 2000 May 1;65(3):213-23

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24