About   Help   FAQ
Tlr5-pA, Tlr5-pB Primer Detail
Primers
  • Name
    Tlr5-pA, Tlr5-pB
  • Primer 1 Sequence
    CATGTCAACAGGGAGCTTTGT
  • Primer 2 Sequence
    ATGAAGCTGCCTTGTAACTTCTCCC
  • ID
    MGI:1860626
  • Region Covered
    3' untranslated region
  • Product Size
    191bp
Genes
Tlr5 toll-like receptor 5
Polymorphisms
J:61532 Sebastiani G, et al., Genomics. 2000 Mar 15;64(3):230-40
Endonuclease Gene Allele Fragments Strains
Tlr5 l 192bp C57BL/6J
s 198bp M. spretus, MOLF/EiJ
Not Specified Tlr5 a not given 129P3/J, A/J, AKR/J, B6.KB2-Cln8mnd, BUB/BnJ, C57BL/6J, C57BL/10J, C57BL/10ScCr, C57L/J, C58/J, NOD/J, NZB/BlNJ, PERA/EiJ, PERA/Rk, PERC/EiJ, RBB/DnJ, RF/J, TIRANO/EiJ
b not given BALB/cJ, C3H/HeJ, C3H/HeN, C3H/HeOuJ, C3HeB/FeJ, C57BR/cdJ, CAST/EiJ, CBA/J, CZECHII/EiJ, DBA/1J, DBA/2J, M. caroli, M. spretus, MOLC/RkJ, MOLD/RkJ, MOLE/Rk, MOLF/EiJ, MOLG/DnJ, NZW/LacJ, P/J, RBA/DnJ, RIIIS/J, SF/CamEiJ, SK/CamEi, SK/CamRk, SKIVE/EiJ
c not given ZALENDE/EiJ
References
J:61532 Sebastiani G, et al., Cloning and characterization of the murine toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics. 2000 Mar 15;64(3):230-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/05/2024
MGI 6.24
The Jackson Laboratory