D5Ncnp7-pA, D5Ncnp7-pB Primer Detail MGI Mouse MGI:1932080

About Help FAQ

D5Ncnp7-pA, D5Ncnp7-pB Primer Detail

Name

D5Ncnp7-pA, D5Ncnp7-pB
Primer 1 Sequence

CATTTGGTATCCTAGAGAAGACTG
Primer 2 Sequence

AACAGGCCAGAGGGAATCAAG
ID

MGI:1932080

D5Ncnp7

DNA segment, Chr 5, National Center of Neurology and Psychiatry 7

J:63229 Wang YL, et al., Genomics. 2000 Jun 15;66(3):333-6

Gene	Allele	Fragments	Strains
D5Ncnp7	b	290bp	C57BL/6J
	c	290bp	CBA/J
	h	282bp	C3H/HeJ
	m	257bp	MSM

J:63229 Wang YL, et al., YAC/BAC-Based physical and transcript mapping around the gracile axonal dystrophy (gad) locus identifies uchl1, pmx2b, atp3a2, and hip2 genes. Genomics. 2000 Jun 15;66(3):333-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13