A039-F, A039-R Primer Detail MGI Mouse MGI:1934198

About Help FAQ

A039-F, A039-R Primer Detail

Name

A039-F, A039-R
Primer 1 Sequence

AAACGGAGTCCACGAAATTG
Primer 2 Sequence

GTCCGGTCCCCTGTAAAAAT
ID

MGI:1934198
Product Size

0.19 kb

A039

DNA segment, A039

J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72

Notes: Polymorphisms for this primer pair were identified by conformational variation.

Gene	Allele	Fragments	Strains
A039	a	not given	129, (C57BL/6 x C57BLKS-Pitx3^ak)F1
	b	not given	C57BL/6
	c	not given	CAST/EiJ
	d	not given	DBA/2
	s	not given	SPRET/EiJ

J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13