About   Help   FAQ
A116-F, A116-R Primer Detail
Primers
  • Name
    A116-F, A116-R
  • Primer 1 Sequence
    GATCAAAAATGAAGGTGACTGTG
  • Primer 2 Sequence
    GATGAGAGAATCTTTGCCAGG
  • ID
    MGI:1934214
  • Region Covered
    intron 9 of Ldb1
  • Product Size
    0.21 kb
Genes
A116 DNA segment, A116
Polymorphisms
J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72
Notes: Polymorphisms for this primer pair were identified by conformational variation.
Endonuclease Gene Allele Fragments Strains
A116 a not given 129, (C57BL/6 x C57BLKS-Pitx3ak)F1
c not given CAST/EiJ
d not given DBA/2
s not given SPRET/EiJ
References
J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/03/2024
MGI 6.24
The Jackson Laboratory