A135-F, A135-R Primer Detail MGI Mouse MGI:1934215

About Help FAQ

A135-F, A135-R Primer Detail

Name

A135-F, A135-R
Primer 1 Sequence

GAGACCTGATTCTTAAGTTTGTCCTC
Primer 2 Sequence

GAGACCTGATTCTTAAGTTTGTCCTC
ID

MGI:1934215
Product Size

0.2 kb

A135

DNA segment, A135

J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72

Gene	Allele	Fragments	Strains
A135	a	largest	129, (C57BL/6 x C57BLKS-Pitx3^ak)F1
	c	smallest	CAST/EiJ
	d	larger	C57BL/6, DBA/2
	s	smaller	SPRET/EiJ

J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24