About   Help   FAQ
Hoxb7-pA, Hoxb7-pB Primer Detail
Primers
  • Name
    Hoxb7-pA, Hoxb7-pB
  • Primer 1 Sequence
    ACCCCATACTTCCCAGTAGC
  • Primer 2 Sequence
    GAAAGAGGCTCGTGAATAGG
  • ID
    MGI:202
Genes
Hoxb7 homeobox B7
Polymorphisms
J:4404 Takahashi N, et al., Genomics. 1993 Apr;16(1):161-8
Notes: Genomic DNA was amplified via PCR, digested with restriction enzyme, electrophoresed on a 4% agarose gel and viewed with ethidium bromide. Two 20.0bp fragments occur in the b allele grouping.
Endonuclease Gene Allele Fragments Strains
MnlI Hoxb7 a not given A/J, AKR/J, CASA/RkJ, CAST/EiJ, CBA/J, M. m. molossinus, MOLF/EiJ
b 20.0,20.0,78.0bp 129P3/J, BALB/cJ, C3H/HeJ, C57BL/6J, C57BL/10J, DBA/2J, SJL/J
s 40.0,78.0bp M. spretus
References
J:4404 Takahashi N, et al., The short 3'-end region of complementary DNAs as PCR-based polymorphic markers for an expression map of the mouse genome. Genomics. 1993 Apr;16(1):161-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory