Actb-pA, Actb-pB Primer Detail MGI Mouse MGI:204

About Help FAQ

Actb-pA, Actb-pB Primer Detail

Name

Actb-pA, Actb-pB
Primer 1 Sequence

CCCAACTTGATGTATGAAGG
Primer 2 Sequence

TTTGTGTAAGGTAAGGTGTGC
ID

MGI:204

Actb

actin, beta

J:4404 Takahashi N, et al., Genomics. 1993 Apr;16(1):161-8

Notes: Genomic DNA was amplified via PCR, digested with restriction enzyme, electrophoresed on a 4% agarose gel and viewed with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
TaqI	Actb	b	119.0bp	129P3/J, A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, C57BL/10J, CASA/RkJ, CAST/EiJ, CBA/J, DBA/2J, M. m. molossinus, MOLF/EiJ, SJL/J
TaqI	Actb	s	43.0,76.0bp	M. spretus

J:4404 Takahashi N, et al., The short 3'-end region of complementary DNAs as PCR-based polymorphic markers for an expression map of the mouse genome. Genomics. 1993 Apr;16(1):161-8

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24