About   Help   FAQ
Gabra6-pA, Gabra6-pB Primer Detail
Primers
  • Name
    Gabra6-pA, Gabra6-pB
  • Primer 1 Sequence
    CTGCAATACTGTTGCTATTTCC
  • Primer 2 Sequence
    AAGTGTAGATATGATGGTAGCC
  • ID
    MGI:210
Genes
Gabra6 gamma-aminobutyric acid type A receptor subunit alpha 6
Polymorphisms
J:4404 Takahashi N, et al., Genomics. 1993 Apr;16(1):161-8
Notes: Genomic DNA was amplified via PCR, digested with restriction enzyme, electrophoresed on a 4% agarose gel and viewed with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
MnlI Gabra6 b 57.0,83.0bp C57BL/6J, CAST/EiJ, DBA/2J, MOLF/EiJ
s 140.0bp M. spretus
RsaI Gabra6 b 140.0bp C57BL/6J, CAST/EiJ, DBA/2J, MOLF/EiJ
s 50.0,90.0bp M. spretus
References
J:4404 Takahashi N, et al., The short 3'-end region of complementary DNAs as PCR-based polymorphic markers for an expression map of the mouse genome. Genomics. 1993 Apr;16(1):161-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory