About   Help   FAQ
Gabrg2-primer1,Gabrg2-primer2 Primer Detail
Primers
  • Name
    Gabrg2-primer1,Gabrg2-primer2
  • Primer 1 Sequence
    TTGGGTACCTCTTCTGCAACCCAGAGGCGAG
  • Primer 2 Sequence
    GTTGGATCCCACATTCGGTGACCACACATAGG
  • ID
    MGI:2152317
  • Region Covered
    coding region of Gabrg2
Genes
Gabrg2 gamma-aminobutyric acid type A receptor, subunit gamma 2
Polymorphisms
J:67847 Buck KJ, et al., Mamm Genome. 1998 Dec;9(12):975-8
Notes: Sequence comparison of the Gabr2g coding region between DBA/2J and C57BL/6J revealed 2 silent mutations (GGC vs GGG at glycine residue 37; ACG vs ACT at threonine residue 210) and one missense mutation (ACT vs GCT at residue 11, threonine vs alanine), respectively. Gabrg2 is a likely candidate gene for the alcohol withdrawal QTL on mouse chromosome 11, Alcw3.
Endonuclease Gene Allele Fragments Strains
Gabrg2 b not given C57BL/6J
d not given DBA/2J
References
J:67847 Buck KJ, et al., Genetic association of a GABA(A) receptor gamma2 subunit variant with severity of acute physiological dependence on alcohol. Mamm Genome. 1998 Dec;9(12):975-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory