D5Dmo2-pA, D5Dmo2-pB Primer Detail MGI Mouse MGI:2152897

About Help FAQ

D5Dmo2-pA, D5Dmo2-pB Primer Detail

Name

D5Dmo2-pA, D5Dmo2-pB
Primer 1 Sequence

GAAGTCCCTGAAGACTAAAG
Primer 2 Sequence

GCTGTCTTTACACATAGTTC
ID

MGI:2152897

D5Dmo2

DNA segment, Chr 5, David Ornitz 2

J:72229 Hurle B, et al., Genomics. 2001 Oct;77(3):189-99

Endonuclease	Gene	Allele	Fragments	Strains
	D5Dmo2	b	0.121 kb	C57BL/6J
	D5Dmo2	c	> 0.121 kb	CAST/EiJ

J:72229 Hurle B, et al., Physical Mapping of the Mouse Tilted Locus Identifies an Association between Human Deafness Loci DFNA6/14 and Vestibular System Development. Genomics. 2001 Oct;77(3):189-99

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13