T59 Primer Detail MGI Mouse MGI:231

T59 Primer Detail

Name

T59
Primer 1 Sequence

ACCTCAGCGGTTCTTTATGAG
Primer 2 Sequence

TGGTCCACCCTGAATGAGTCC
ID

MGI:231
Product Size

90bp
Synonyms

TJ-2.29

D6Nds4

DNA segment, Chr 6, Nuffield Department of Surgery 4

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Endonuclease	Gene	Allele	Fragments	Strains
	D6Nds4	n	smaller	AKR/J, B6.PL-Thy1^a/SnJ, C57BL/6, C57BL/10-H2^g7, DBA/2J, NOD, NON
	D6Nds4	s	larger	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D6Nds4	e	91bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	f	114bp	CAST/EiJ
	s	112bp	SPRET/EiJ

J:29406 Davies PO, et al., Mamm Genome. 1995 Oct;6(10):738-40

Endonuclease	Gene	Allele	Fragments	Strains
	D6Nds4	n	not given	NOD
	D6Nds4	p	not given	PWK/Pas

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Nds4	m	88bp	MOLF/EiJ
Not Specified	D6Nds4	s	130bp	129/Sv

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:15643 Peichel CL, et al., Mapping the midkine family of developmentally regulated signaling molecules. Mamm Genome. 1993 Nov;4(11):632-8

J:29406 Davies PO, et al., An anchored molecular map of mouse chromosome 6 with an analysis of interference. Mamm Genome. 1995 Oct;6(10):738-40

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24