About   Help   FAQ
D5Mit184 Primer Detail
Primers
  • Name
    D5Mit184
  • Primer 1 Sequence
    AAGAGAGACATACACAAACAGACACA
  • Primer 2 Sequence
    TTTCTTAACAAGTTTCTAGCAATTTCC
  • ID
    MGI:2404
  • Other IDs
    D5Mit184 (BROAD)
  • Note
    D5Mit184 was MT1716
    Additional information: MIT STS Marker Data Files
Genes
D5Mit184 DNA segment, Chr 5, Massachusetts Institute of Technology 184
Polymorphisms
J:32962 Elliott RW, MGI Direct Data Submission. 1996-04;
Endonuclease Gene Allele Fragments Strains
D5Mit184 b not given C57BL/6Ha
i not given ICR/Ha
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit184 c 135bp CBA/CaOlaHsd
s 116bp SWR/OlaHsd
References
J:32962 Elliott RW, Errata for the Mouse Genetic Maps at Whitehead/MIT. MGI Direct Data Submission. 1996-04;
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
08/02/2024
MGI 6.24 		The Jackson Laboratory