ERalpha-pA, ERalpha-pB Primer Detail MGI Mouse MGI:2656183

About Help FAQ

ERalpha-pA, ERalpha-pB Primer Detail

Name

ERalpha-pA, ERalpha-pB
Primer 1 Sequence

GGCCTGACTCTGCAGCAGCAG
Primer 2 Sequence

GTTGGGGAAGCCCTCTGCTTC
ID

MGI:2656183
Region Covered

Nucleotides 1682-1702 and 1961-1981 of GenBank sequence M38651
Product Size

300bp

Esr1

estrogen receptor 1 (alpha)

Assay Results

35

M38651 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:60130 Kuppers E, et al., Expression of estrogen receptor-alpha and beta mRNA in the developing and adult mouse striatum. Neurosci Lett. 1999 Dec 3;276(2):95-8

J:63372 Ivanova T, et al., Ontogenetic expression and sex differences of aromatase and estrogen receptor-alpha/beta mRNA in the mouse hippocampus. Cell Tissue Res. 2000 May;300(2):231-7

J:85725 Beyer C, et al., Ontogenetic expression of estrogen and progesterone receptors in the mouse lung. Biol Neonate. 2003;84(1):59-63

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13