3.MMGMCSFG Primer Detail MGI Mouse MGI:286

3.MMGMCSFG Primer Detail

Name

3.MMGMCSFG
Primer 1 Sequence

CTGTGCAACAGACTAAGCCT
Primer 2 Sequence

CTGTAACACAATAACCAGGCA
ID

MGI:286
Product Size

127bp
Synonyms

3MMGMCSFG, Csfgm-pE, Csfgm-pF, MMGMCSFG

Csf2

colony stimulating factor 2 (granulocyte-macrophage)

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Csf2	b	smaller	B6.PL-Thy1^a, C57BL/6J
	d	larger	B10.H2^nod, DBA/2J, NOD, NON
	s	smallest	M. spretus

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both. The product size of 165bp reported here varies somewhat from the size reported in other references.

Gene	Allele	Fragments	Strains
Csf2	a	largest	C57BL/10-H2^g7, DBA/2J, NOD, NON
	a'	largest	A, B10.BR-H2^k2 H2-T18^a/SgSnJ, C3H/He, C58, CBA/CaH-T(14;15)6Ca, DBA/2, NOD/LtCrc
	b	2nd largest	B6.PL-Thy1^a, C57BL/6J
	b'	2nd largest	BALB/cCrc, MEV/1TyJ
	c	3rd largest	SPR

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Csf2	a	largest	129S2/SvPas, C3H/HePas, DBA/2Pas, DDK/Pas, PWK/Pas, STS/A
	b	2nd largest	BALB/cPas, C57BL/6Pas
	c	3rd largest	SEG/Pas, SPE/Pas
	d	4th largest	SPR/Smh

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Csf2	a	largest	A/JCrc, B10.D2-H2^d/Nimr, C3H/HeCrc, C58/OlaCrc, CBA/CaCrc, NOD/Crc
	b	larger	BALB/cCrc
	c	smaller	C57L/J
	d	smallest	NZW/Ola

J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202

Endonuclease	Gene	Allele	Fragments	Strains
	Csf2	l	135bp	LS
	Csf2	s	152bp	SS

J:53010 Guler ML, et al., J Immunol. 1999 Feb 1;162(3):1339-47

Endonuclease	Gene	Allele	Fragments	Strains
	Csf2	b	not given	BALB/c
	Csf2	d	not given	B10.D2-H2^d

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202

J:53010 Guler ML, et al., Tpm1, a locus controlling IL-12 responsiveness, acts by a cell-autonomous mechanism. J Immunol. 1999 Feb 1;162(3):1339-47

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24