14.MMNFIL Primer Detail MGI Mouse MGI:296

14.MMNFIL Primer Detail

Name

14.MMNFIL
Primer 1 Sequence

GCAATTAATCACTGCAGTCCATTA
Primer 2 Sequence

ATTCTTTTAGCCAGGGTCGCAT
ID

MGI:296
Product Size

197bp
Synonyms

14MMNFIL, MMNFIL

Nefl

neurofilament, light polypeptide

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Nefl	a	largest	BALB/cBy
	b	smallest	B6.PL-Thy1^a, B10.H2^nod, C3H/HeJ, C57BL/6J, DBA/2J, M. spretus
	n	smaller	AKR/J, NOD, NON

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.

Gene	Allele	Fragments	Strains
Nefl	a	largest	BALB/cPas
	a'	largest	A, BALB/cCrc, NOD/LtCrc
	b	2nd largest	AKR, NOD, NON
	b'	2nd largest	B10.BR-H2^k2 H2-T18^a/SgSnJ, C3H/He, C58, DBA/2J, MEV/1TyJ
	c	3rd largest	B6.PL-Thy1^a, C3H/He, C57BL/6J, C57BL/10-H2^g7, DBA/2J, SPR

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Nefl	a	largest	BALB/cPas
	b	2nd largest	STS/Pas
	c	3rd largest	129S2/SvPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, PWK/Pas, SEG/Pas, SPE/Pas, SPR/Smh

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Nefl	a	largest	NZW/Ola
	b	larger	A/JCrc, BALB/cCrc, CBA/CaCrc, NOD/Crc
	c	smaller	C3H/HeCrc, C58/OlaCrc
	d	smallest	AKR/Nimr, B10.D2-H2^d/Nimr, C57L/J

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24