T30 Primer Detail MGI Mouse MGI:30

T30 Primer Detail

Name

T30
Primer 1 Sequence

TCCTTGGAGTTAAAACTTGGA
Primer 2 Sequence

AGATAAATTCAATGAGTCCTA
ID

MGI:30
Product Size

135bp
Synonyms

TJ-2.106

D9Nds2

DNA segment, Chr 9, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D9Nds2	h	smallest	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	large	NON
	o	small	AKR/J, DBA/2J, NOD
	s	larger	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D9Nds2	d	125bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
	e	121bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	130bp	CAST/EiJ, LP/J
	i	127bp	NON/ShiLt
	s	110bp	SPRET/EiJ

J:12629 Nass SJ, et al., Mamm Genome. 1993;4(6):333-7

Gene	Allele	Fragments	Strains
D9Nds2	b	not given	C57BL/6J
	d	not given	DBA/2J
	h	not given	C3H/HeJ

J:15208 Imai K, et al., Mamm Genome. 1993;4(10):560-4

Endonuclease	Gene	Allele	Fragments	Strains
	D9Nds2	b	125,118bp	C57BL/6J
	D9Nds2	t	130,125bp	TKDU/DnJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D9Nds2	a	larger	AKR/J
	b	smallest	C57BL/J, LG/J
	s	smaller	SM/J

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Nds2	m	135bp	MOLF/EiJ
Not Specified	D9Nds2	s	150bp	129/Sv

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:12629 Nass SJ, et al., Mapping of the Mod-1 locus on mouse chromosome 9. Mamm Genome. 1993;4(6):333-7

J:15208 Imai K, et al., The genetic map around the tail kinks (tk) locus on mouse chromosome 9. Mamm Genome. 1993;4(10):560-4

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13