18.MMKALL Primer Detail MGI Mouse MGI:300

18.MMKALL Primer Detail

Name

18.MMKALL
Primer 1 Sequence

ACAGTCATTAGTCATTCAAAC
Primer 2 Sequence

TGGAGTACTTAGGTTGTGCTC
ID

MGI:300
Product Size

177bp
Synonyms

18MMKALL, MMKALL

Klk1

kallikrein 1

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Endonuclease	Gene	Allele	Fragments	Strains
	Klk1	c	present	B6.PL-Thy1^a, B10.H2^nod, C57BL/6J, CBA/J, DBA/2J, NOD, NON

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Klk1	a	largest	A/JCrc, BALB/cCrc, NZW/Ola
	b	larger	AKR/Nimr, B10.D2-H2^d/Nimr, C58/OlaCrc, CBA/CaCrc, NOD/Crc
	c	smaller	C3H/HeCrc, C57L/J

J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76

Endonuclease	Gene	Allele	Fragments	Strains
	Klk1	b	smaller	C57BL/6J
	Klk1	r	larger	RF/J

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24