19.MMNGFG2 Primer Detail MGI Mouse MGI:301

19.MMNGFG2 Primer Detail

Name

19.MMNGFG2
Primer 1 Sequence

CTCCACATGTGTATGTGTATG
Primer 2 Sequence

ATGGAGGCCGAAGAAAGAATC
ID

MGI:301
Product Size

147bp
Synonyms

19MMNGFG2, MMNGFG2

Klk1b3

kallikrein 1-related peptidase b3

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Klk1b3	b	smaller	B6.PL-Thy1^a, B10.H2^nod
	n	smallest	NOD, NON
	s	larger	M. spretus

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Klk1b3	a	largest	SEG/Pas, SPR/Smh
	b	2nd largest	SPE/Pas
	c	3rd largest	PWK/Pas
	d	4th largest	DBA/2Pas, STS/Pas
	e	5th largest	129S2/SvPas, C3H/HePas, C57BL/6Pas, DDK/Pas
	f	6th largest	BALB/cPas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Klk1b3	a	largest	C3H/HeCrc
	b	larger	B10.D2-H2^d/Nimr
	c	smaller	A/JCrc, AKR/Nimr, BALB/cCrc, NOD/Crc, NZW/Ola
	d	smallest	C57L/J, C58/OlaCrc, CBA/CaCrc

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24