21.MMMHCQ4A Primer Detail MGI Mouse MGI:302

21.MMMHCQ4A Primer Detail

Name

21.MMMHCQ4A
Primer 1 Sequence

CCTGCAGGAATATCAATAGTG
Primer 2 Sequence

ATACAGAGAAACCCTATCTCAA
ID

MGI:302
Product Size

214bp
Synonyms

21MMMHCQ4A, MMMHCQ4A

H2-Q4

histocompatibility 2, Q region locus 4

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
H2-Q4	b	larger	B6.PL-Thy1^a, C57BL/6J
	d	smaller	DBA/2J
	h	smallest	B10.H2^nod, NOD
	n	large	NON
	s	largest	M. spretus

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
H2-Q4	a	largest	SEG/Pas, SPE/Pas, SPR/Smh
	b	2nd largest	DDK/Pas
	c	3rd largest	129S2/SvPas, C57BL/6Pas
	d	4th largest	C3H/HePas, PWK/Pas, STS/Pas
	e	5th largest	BALB/cPas, DBA/2Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
H2-Q4	a	largest	C57L/J, NZW/Ola
	b	larger	AKR/Nimr, C3H/HeCrc, C58/OlaCrc, CBA/CaCrc
	c	smaller	A/JCrc, B10.D2-H2^d/Nimr, BALB/cCrc
	d	smallest	NOD/Crc

J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42

Gene	Allele	Fragments	Strains
H2-Q4	n	160bp	NOD/Shi
	o	220bp	NON/Shi
	t	204bp	CTS/Shi

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24