About   Help   FAQ
21.MMMHCQ4A Primer Detail
Primers
  • Name
    21.MMMHCQ4A
  • Primer 1 Sequence
    CCTGCAGGAATATCAATAGTG
  • Primer 2 Sequence
    ATACAGAGAAACCCTATCTCAA
  • ID
    MGI:302
  • Product Size
    214bp
  • Synonyms
    21MMMHCQ4A, MMMHCQ4A
Genes
H2-Q4 histocompatibility 2, Q region locus 4
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
H2-Q4 b larger B6.PL-Thy1a, C57BL/6J
d smaller DBA/2J
h smallest B10.H2nod, NOD
n large NON
s largest M. spretus
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
H2-Q4 a largest SEG/Pas, SPE/Pas, SPR/Smh
b 2nd largest DDK/Pas
c 3rd largest 129S2/SvPas, C57BL/6Pas
d 4th largest C3H/HePas, PWK/Pas, STS/Pas
e 5th largest BALB/cPas, DBA/2Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
H2-Q4 a largest C57L/J, NZW/Ola
b larger AKR/Nimr, C3H/HeCrc, C58/OlaCrc, CBA/CaCrc
c smaller A/JCrc, B10.D2-H2d/Nimr, BALB/cCrc
d smallest NOD/Crc
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
H2-Q4 n 160bp NOD/Shi
o 220bp NON/Shi
t 204bp CTS/Shi
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory