22.MMTNFAB Primer Detail MGI Mouse MGI:303

22.MMTNFAB Primer Detail

Name

22.MMTNFAB
Primer 1 Sequence

TTCCTGTGGCGGCCTTATCAG
Primer 2 Sequence

AGACAATGGGTAACAGAGGCA
ID

MGI:303
Product Size

135bp
Synonyms

22MMTNFAB, MMTNFAB, T68

D17Nds3	DNA segment, Chr 17, Nuffield Department of Surgery 3
Lta	lymphotoxin A

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Lta	b	larger	B6.PL-Thy1^a, C57BL/6J
	n	smaller	B10.H2^nod, DBA/2J, NOD, NON
	s	smallest	M. spretus

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Lta	a	largest	PWK/Pas
	b	2nd largest	C3H/HePas
	c	3rd largest	129S2/SvPas, C57BL/6Pas, DDK/Pas, STS/Pas
	d	4th largest	BALB/cPas, DBA/2Pas
	e	5th largest	SEG/Pas, SPE/Pas, SPR/Smh

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Lta	a	largest	C57L/J, NOD/Crc
	b	larger	A/JCrc, C3H/HeCrc, C58/OlaCrc
	c	smaller	AKR/Nimr, B10.D2-H2^d/Nimr, BALB/cCrc, CBA/CaCrc, NZW/Ola

J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77

Gene	Allele	Fragments	Strains
D17Nds3	a	larger	A.SW-H2^s/Sn
	b	smallest	B10.D2-Hc⁰ H2^d H2-T18^c/oSnJ
	c	smaller	C3.NB-H2^p, P/J
	k	largest	B10.K-H2^k

J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42

Endonuclease	Gene	Allele	Fragments	Strains
	D17Nds3	n	140bp	NOD/Shi, NON/Shi
	D17Nds3	t	145bp	CTS/Shi

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Nds2	a	160bp	BN/aW
	b	150bp	A.CA/W, AKR/W, CBA/W
	c	134bp	129/SvW, C57BL/6W, C57BL/10W
	d	126bp	BALB/cW, BN/aW, DBA/2W

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:4113 Snoek M, et al., Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus [published erratum appears in Genomics 1993 Aug;17(2):533]. Genomics. 1993 Feb;15(2):350-6

J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77

J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24