About   Help   FAQ
25.MMCD46 Primer Detail
Primers
  • Name
    25.MMCD46
  • Primer 1 Sequence
    AGGAGAGGATTAACTCTTGAA
  • Primer 2 Sequence
    CATGCATGTGTGCAACATGCG
  • ID
    MGI:306
  • Product Size
    123bp
  • Synonyms
    25MMCD46, MMCD46
Genes
Cd4 CD4 antigen
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Cd4 b larger B6.PL-Thy1a, B10.H2nod, C57BL/6J, CBA/J, DBA/2J, NOD, NON
s smaller M. spretus
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Cd4 a largest B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, CBA, DBA/2J, NOD, NON
a' largest C58
b 2nd largest SPR
b' 2nd largest A, B10.BR-H2k2 H2-T18a/SgSnJ, BALB/cCrc, C3H/He, CBA/CaH-T(14;15)6Ca, DBA/2J, MEV/1TyJ, NOD/LtCrc
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Cd4 a largest 129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
b 2nd largest PWK/Pas
c 3rd largest SEG/Pas, SPE/Pas, SPR/Smh
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Cd4 a largest C58/OlaCrc
b smallest A/JCrc, AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, C3H/HeCrc, C57L/J, CBA/CaCrc, NOD/Crc, NZW/Ola
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory