About   Help   FAQ
31.MMDRF3 Primer Detail
Primers
  • Name
    31.MMDRF3
  • Primer 1 Sequence
    ATCGTAATCAGATTCCCTCTTCTG
  • Primer 2 Sequence
    GTCATTACATGTATTCTCTGTGTT
  • ID
    MGI:312
  • Product Size
    121bp
  • Synonyms
    31MMDRF3, MMDRF3
Genes
D6Nds1 DNA segment, Chr 6, Nuffield Department of Surgery 1
Polymorphisms
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
D6Nds1 a largest SPR
a' largest A, B10.BR-H2k2 H2-T18a/SgSnJ, BALB/cCrc, C3H/He, DBA/2J
b 2nd largest AKR/J, B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, DBA/2J
b' 2nd largest C58, MEV/1TyJ, NOD/LtCrc
c 3rd largest NON
d 4th largest NOD
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
D6Nds1 a largest SEG/Pas, SPE/Pas
b 2nd largest SPR/Smh
c 3rd largest 129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
d 4th largest PWK/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
D6Nds1 a largest A/JCrc, AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, C3H/HeCrc, C57L/J, NZW/Ola
b larger NOD/Crc
c smaller C58/OlaCrc
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:4074 de Gouyon B, et al., Genetic analysis of diabetes and insulitis in an interspecific cross of the nonobese diabetic mouse with Mus spretus. Proc Natl Acad Sci U S A. 1993 Mar 1;90(5):1877-81
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory

Building initial tooltip...