About   Help   FAQ
34.MMCYO3 Primer Detail
Primers
  • Name
    34.MMCYO3
  • Primer 1 Sequence
    AGTTTTAGGCTAGTATAGGTT
  • Primer 2 Sequence
    ACTGGAACCTTAGAGCATGAG
  • ID
    MGI:315
  • Product Size
    198bp
  • Synonyms
    34MMCYO3, MMCYO3
Genes
Cyp1a2 cytochrome P450, family 1, subfamily a, polypeptide 2
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Cyp1a2 b smaller B6.PL-Thy1a, B10.H2nod, C57BL/6J, NON
n smallest DBA/2J, NOD
s larger M. spretus
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Cyp1a2 a largest SPR
a' largest C3H/He
b 2nd largest B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, NON
b' 2nd largest A
c 3rd largest DBA/2J, NOD
c' 3rd largest B10.BR-H2k2 H2-T18a/SgSnJ, BALB/cCrc, C58
d' 4th largest CBA/CaH-T(14;15)6Ca, DBA/2J, MEV/1TyJ, NOD/LtCrc
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Cyp1a2 a largest PWK/Pas
b 2nd largest C3H/HePas
c 3rd largest DDK/Pas
d 4th largest SEG/Pas, SPE/Pas, SPR/Smh
e 5th largest BALB/cPas, C57BL/6Pas
f 6th largest 129S2/SvPas, DBA/2Pas, STS/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Cyp1a2 a largest C3H/HeCrc
b larger A/JCrc
c smaller AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, C57L/J, C58/OlaCrc, NZW/Ola
d smallest CBA/CaCrc, NOD/Crc
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory