39.MMGFAPD Primer Detail MGI Mouse MGI:320

39.MMGFAPD Primer Detail

Name

39.MMGFAPD
Primer 1 Sequence

AACTGTTCAAAGCCATTTCG
Primer 2 Sequence

CTATGGACTCACAGCCAGGCT
ID

MGI:320
Product Size

159bp
Synonyms

39MMGFAPD, MMGFAPD

Gfap

glial fibrillary acidic protein

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Gfap	b	smallest	B6.PL-Thy1^a, B10.H2^nod, C57BL/6J, NOD, NON
	d	smaller	DBA/2J
	s	larger	M. spretus

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Gfap	a	largest	A/JCrc, C3H/HeCrc
	b	larger	B10.D2-H2^d/Nimr, BALB/cCrc, C58/OlaCrc, NOD/Crc
	c	smaller	AKR/Nimr, C57L/J, CBA/CaCrc, NZW/Ola

J:1723 Nonaka M, et al., Genomics. 1992 Aug;13(4):1082-7

Notes: After amplification, the products were resolved on a 2% polyacrylamide gel.

Endonuclease	Gene	Allele	Fragments	Strains
	Gfap	h	smaller	C3H/HeJ
	Gfap	s	larger	M. spretus

J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202

Endonuclease	Gene	Allele	Fragments	Strains
	Gfap	l	180bp	LS
	Gfap	s	165bp	SS

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:1723 Nonaka M, et al., Molecular cloning of mouse beta 2-glycoprotein I and mapping of the gene to chromosome 11. Genomics. 1992 Aug;13(4):1082-7

J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24