42.MMIL4G12 Primer Detail MGI Mouse MGI:323

42.MMIL4G12 Primer Detail

Name

42.MMIL4G12
Primer 1 Sequence

GTCTGCTGTGGCATATTCTG
Primer 2 Sequence

GGCATTTCTCATTCAGATTC
ID

MGI:323
Product Size

117bp
Synonyms

Il4-pA, Il4-pB

Il4

interleukin 4

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Endonuclease	Gene	Allele	Fragments	Strains
	Il4	b	smaller	B6.PL-Thy1^a, C57BL/6J, NON
	Il4	s	larger	B10.H2^nod, DBA/2J, M. spretus, NOD

J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7

Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.

Gene	Allele	Fragments	Strains
Il4	a	109bp	PL/J
	b	115bp	NON, SJL, SWR
	c	117bp	DBA/2, M. spretus, NZB
	d	119bp	NOD
	e	121bp	M. m. musculus
	f	111bp	AKR, BALB/c, C3H/He, C57BL/6J, CBA, DBA/1, M. m. domesticus, MRL, MRL-Fas^lpr, NZW, P/J, SM/J

J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202

Endonuclease	Gene	Allele	Fragments	Strains
	Il4	l	111.0bp	LS
	Il4	s	115.0bp	SS

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24