48.MMIL5G Primer Detail MGI Mouse MGI:328

48.MMIL5G Primer Detail

Name

48.MMIL5G
Primer 1 Sequence

CCTTTCTGAAAGTATTAAGAGT
Primer 2 Sequence

ACAACCATCTGCATATCCAGC
ID

MGI:328
Product Size

288bp
Synonyms

48MMIL5G, Il5-pA, Il5-pB, MMIL5G

Il5

interleukin 5

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Il5	b	largest	B6.PL-Thy1^a, C57BL/6J, DBA/2J
	d	smaller	NON
	n	larger	B10.H2^nod, NOD
	s	smallest	M. spretus

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Endonuclease	Gene	Allele	Fragments	Strains
	Il5	a	largest	129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
	Il5	b	2nd largest	PWK/Pas, SEG/Pas, SPE/Pas, SPR/Smh

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Il5	a	largest	A/JCrc
	b	larger	AKR/Nimr, B10.D2-H2^d/Nimr, BALB/cCrc, C3H/HeCrc, C57L/J, C58/OlaCrc, CBA/CaCrc, NOD/Crc
	c	smaller	NZW/Ola

J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7

Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.

Gene	Allele	Fragments	Strains
Il5	a	206bp	M. spretus
	b	208bp	M. m. musculus
	c	210bp	NZW
	d	280bp	M. m. domesticus
	e	282bp	SWR
	f	286bp	NOD
	g	290bp	NZB
	h	302bp	PL/J, SJL
	i	288bp	AKR, BALB/c, C3H/He, C57BL/6J, CBA, DBA/1, DBA/2, MRL, MRL-Fas^lpr, NON, P/J, SM/J

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24