Cdx2-pE, Cdx2-pF Primer Detail MGI Mouse MGI:3777368

About Help FAQ

Cdx2-pE, Cdx2-pF Primer Detail

Name

Cdx2-pE, Cdx2-pF
Primer 1 Sequence

GCAGTCCCTAGGAAGCCAAGTGA
Primer 2 Sequence

CTCTCGGAGAGCCCAAGTGTG
ID

MGI:3777368

Cdx2

caudal type homeobox 2

Assay Results

8

J:98502 Strumpf D, et al., Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development. 2005 May;132(9):2093-102

J:126338 Yagi R, et al., Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development. 2007 Nov;134(21):3827-36

J:130047 Nishioka N, et al., Tead4 is required for specification of trophectoderm in pre-implantation mouse embryos. Mech Dev. 2008 Mar-Apr;125(3-4):270-83

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13