Grpr-pA, Grpr-pB Primer Detail MGI Mouse MGI:499

Grpr-pA, Grpr-pB Primer Detail

Name

Grpr-pA, Grpr-pB
Primer 1 Sequence

TGGGACAGAACCAACATCAAC
Primer 2 Sequence

TTGGAGCCATCTCAAAGCTTC
ID

MGI:499
Product Size

240bp

Grpr

gastrin releasing peptide receptor

J:13242 Maslen GL, et al., Genomics. 1993 Jul;17(1):106-9

Gene	Allele	Fragments	Strains
Grpr	a	238bp	AKR/J
	b	240bp	101/H, 102/El, 129S1/Sv-Oca2⁺ Tyr⁺ Kitl⁺ Mc1r^e, C3H/HeH, C57BL/6J, CBA/CaH, DBA/2Ola, JU/FaCt, SDH, SWR/Ola
	s	252bp	M. spretus

J:19674 Stambolian D, et al., Genomics. 1994 Jul 15;22(2):377-80

Endonuclease	Gene	Allele	Fragments	Strains
	Grpr	d	240bp	DBA/2
	Grpr	s	252bp	M. spretus

J:25179 Zhou E, et al., Mamm Genome. 1995 May;6(5):357-9

Endonuclease	Gene	Allele	Fragments	Strains
	Grpr	d	252bp	DBA/2
	Grpr	s	240bp	M. spretus

J:13242 Maslen GL, et al., Comparative mapping of the Grpr locus on the X chromosomes of man and mouse. Genomics. 1993 Jul;17(1):106-9

J:19674 Stambolian D, et al., Mapping of the X-linked cataract (Xcat) mutation, the gene implicated in the Nance Horan syndrome, on the mouse X chromosome. Genomics. 1994 Jul 15;22(2):377-80

J:25179 Zhou E, et al., Exclusion of three candidate genes, Grpr, Cxn33, and Pdha1, for the X-linked cataract gene on the distal region of the mouse chromosome X. Mamm Genome. 1995 May;6(5):357-9

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24