Il7-pA, Il7-pB Primer Detail MGI Mouse MGI:509

About Help FAQ

Il7-pA, Il7-pB Primer Detail

Name

Il7-pA, Il7-pB
Primer 1 Sequence

GACTGGATGGACTCACAAGA
Primer 2 Sequence

TTCTGCTGCCGCCGATGTAA
ID

MGI:509
Product Size

198bp

Il7

interleukin 7

J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7

Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.

Gene	Allele	Fragments	Strains
Il7	a	196bp	BALB/c, C3H/HeJ, M. spretus
	b	199bp	CBA, DBA/1, M. m. domesticus, PL/J, SJL
	c	200bp	MRL, SM/J
	d	203bp	M. m. musculus
	e	198bp	AKR, C57BL/6J, DBA/2, MRL-Fas^lpr, NOD, NON, NZB, NZW, P/J, SWR

J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24