DB41, DB42 Primer Detail MGI Mouse MGI:51

DB41, DB42 Primer Detail

Name

DB41, DB42
Primer 1 Sequence

GACTAGGCTGCAACAGCTTCC
Primer 2 Sequence

CTCCTTGGCTGTTATCTTCGG
ID

MGI:51
Product Size

100-300bp

Nppa

natriuretic peptide type A

J:2643 Beier DR, et al., Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6

Notes: Radioisotopically labeled PCR products were electrophoresed on a 5% nondenaturing polyacrylamide gel and subsequently analyzed using autoradiography.

Gene	Allele	Fragments	Strains
Nppa	a	multiple	AKR/J, C3H/HeJ, C57L/J, DBA/2J
	b	multiple	C57BL/6J
	s	multiple	M. spretus

J:4594 Eicher EM, et al., Mamm Genome. 1993;4(4):226-9

Endonuclease	Gene	Allele	Fragments	Strains
	Nppa	b	smaller	C57BL/6J
	Nppa	s	larger	M. spretus

J:2643 Beier DR, et al., Mapping genes in the mouse using single-strand conformation polymorphism analysis of recombinant inbred strains and interspecific crosses. Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6

J:4594 Eicher EM, et al., Molecular markers that define the distal ends of mouse autosomes 4, 13, and 19 and the sex chromosomes. Mamm Genome. 1993;4(4):226-9

J:24376 Beier DR, et al., Haplotype analysis of intra-specific backcross curly-tail mice confirms the localization of ct to chromosome 4. Mamm Genome. 1995 Apr;6(4):269-72

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24