Ifg-pA, Ifg-pB Primer Detail MGI Mouse MGI:510

About Help FAQ

Ifg-pA, Ifg-pB Primer Detail

Name

Ifg-pA, Ifg-pB
Primer 1 Sequence

GGTGACCTTGTGACAAGCTC
Primer 2 Sequence

TGCTGTGTGGTCTGTCTGTC
ID

MGI:510
Product Size

239bp

Ifng

interferon gamma

J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7

Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.

Gene	Allele	Fragments	Strains
Ifng	a	206bp	M. spretus
	b	232bp	SJL
	c	234bp	NZB
	d	241bp	BALB/c, DBA/1, DBA/2, NOD, P/J, PL/J
	e	243bp	C3H/HeJ, CBA, MRL
	f	247bp	M. m. domesticus
	g	239bp	AKR, C57BL/6J, M. m. musculus, MRL-Fas^lpr, NON, NZW, SM, SWR

J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13