D1Mcg1-pA, D1Mcg1-pB Primer Detail MGI Mouse MGI:511

D1Mcg1-pA, D1Mcg1-pB Primer Detail

Name

D1Mcg1-pA, D1Mcg1-pB
Primer 1 Sequence

AGCCTGACTCAACAAGACAG
Primer 2 Sequence

GTGAACTGTGTACTCTCCTC
ID

MGI:511
Product Size

275bp

D1Mcg163	DNA segment, Chr 1, McGill University 163
D1Mcg1	DNA segment, Chr 1, McGill University 1

J:12786 Malo D, et al., Genomics. 1993 Jun;16(3):655-63

Notes: Genomic DNA was amplified via PCR, electrophoresed on an 8-12% nondenaturing polyacrylamide gel and visualized with ethidium bromide.

Gene	Allele	Fragments	Strains
D1Mcg1	a	smaller	A/J, C3H/HeJ
	b	smallest	C57BL/6J
	k	large	AKR/J, DBA/2J
	l	small	C57L/J
	s	largest	M. spretus

J:20139 Malo D, et al., Genomics. 1994 Sep 1;23(1):51-61

Gene	Allele	Fragments	Strains
D1Mcg163	a	295bp	SWR/J
	b	293bp	M. spretus
	c	291bp	P/J
	d	289bp	AKR/J, BUB/BnJ, CBA/J, DBA/1J, DBA/2J, NOD/ShiLt, PL/J, RF/J, RIIIS/J, SJL/J
	e	287bp	129P3/J, C57BR/cdJ, C57L/J, LP/J, NZW/LacJ
	f	285bp	A/J, C3H/HeJ, C58/J, CE/J, NZB/BlNJ, SWV
	g	261bp	BALB/cJ, C57BL/6J, C57BL/10J

J:12786 Malo D, et al., High-resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 1993 Jun;16(3):655-63

J:20139 Malo D, et al., Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics. 1994 Sep 1;23(1):51-61

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13