About   Help   FAQ
D1Mcg2-pA, D1Mcg2-pB Primer Detail
Primers
  • Name
    D1Mcg2-pA, D1Mcg2-pB
  • Primer 1 Sequence
    GCTACAGTGTACTCATATAC
  • Primer 2 Sequence
    GCAGCACAGCATACAGTTAG
  • ID
    MGI:516
  • Product Size
    228bp
Genes
D1Mcg105 DNA segment, Chr 1, McGill University 105
D1Mcg2 DNA segment, Chr 1, McGill University 2
Polymorphisms
J:12786 Malo D, et al., Genomics. 1993 Jun;16(3):655-63
Notes: Genomic DNA was amplified via PCR, electrophoresed on an 8-12% nondenaturing polyacrylamide gel and visualized with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D1Mcg2 a larger A/J, AKR/J, C3H/HeJ, C57L/J, DBA/2J
b largest C57BL/6J
s smaller M. spretus
J:20139 Malo D, et al., Genomics. 1994 Sep 1;23(1):51-61
Endonuclease Gene Allele Fragments Strains
D1Mcg105 a 236bp P/J
b 234bp 129P3/J, CBA/J, LP/J, NZB/BlNJ
c 232bp C57BL/10J
d 230bp BALB/cJ, C57BL/6J, CE/J, DBA/1J, NOD/ShiLt, NZW/LacJ, SWR/J, SWV
e 226bp RIIIS/J
f 222bp A/J, AKR/J, C3H/HeJ, C57BR/cdJ, C57L/J, C58/J, DBA/2J
g 216bp BUB/BnJ, PL/J, RF/J, SJL/J
h 204bp M. spretus
References
J:12786 Malo D, et al., High-resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 1993 Jun;16(3):655-63
J:20139 Malo D, et al., Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics. 1994 Sep 1;23(1):51-61
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/19/2024
MGI 6.24
The Jackson Laboratory