D1Mcg4-pA, D1Mcg4-pB Primer Detail MGI Mouse MGI:518

D1Mcg4-pA, D1Mcg4-pB Primer Detail

Name

D1Mcg4-pA, D1Mcg4-pB
Primer 1 Sequence

CCGATTTCTGGTCCTTCCTG
Primer 2 Sequence

GTCAACAATGCCCCTTGAAC
ID

MGI:518
Product Size

168bp

Vil1	villin 1
D1Mcg4	DNA segment, Chr 1, McGill University 4

J:12786 Malo D, et al., Genomics. 1993 Jun;16(3):655-63

Notes: Genomic DNA was amplified via PCR, electrophoresed on an 8-12% nondenaturing polyacrylamide gel and visualized with ethidium bromide.

Gene	Allele	Fragments	Strains
D1Mcg4	a	smaller	A/J, C3H/HeJ
	b	small	C57BL/6J
	d	large	DBA/2J
	k	larger	AKR/J
	l	largest	C57L/J
	s	smallest	M. spretus

J:20139 Malo D, et al., Genomics. 1994 Sep 1;23(1):51-61

Gene	Allele	Fragments	Strains
Vil1	a	180bp	C57BR/cdJ, C57L/J, C58/J
	b	176bp	AKR/J
	c	172bp	CE/J, DBA/1J, NZW/LacJ, RIIIS/J, SWV
	d	170bp	DBA/2J
	e	168bp	129P3/J, BALB/cJ, C57BL/6J, C57BL/10J, LP/J, P/J
	f	164bp	A/J, BUB/BnJ, C3H/HeJ, CBA/J, NOD/ShiLt, NZB/BlNJ, PL/J, RF/J, SJL/J
	g	160bp	SWR/J
	h	138bp	M. spretus

J:12786 Malo D, et al., High-resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 1993 Jun;16(3):655-63

J:20139 Malo D, et al., Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics. 1994 Sep 1;23(1):51-61

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24