D1Mcg5-pA, D1Mcg5-pB Primer Detail MGI Mouse MGI:519

D1Mcg5-pA, D1Mcg5-pB Primer Detail

Name

D1Mcg5-pA, D1Mcg5-pB
Primer 1 Sequence

GTTTGCAGAAGCCTGACTCT
Primer 2 Sequence

AACCAGGAGGGGGTGTGTGA
ID

MGI:519
Product Size

165bp

D1Mcg101	DNA segment, Chr 1, McGill University 101
D1Mcg5	DNA segment, Chr 1, McGill University 5

J:12786 Malo D, et al., Genomics. 1993 Jun;16(3):655-63

Notes: Genomic DNA was amplified via PCR, electrophoresed on an 8-12% nondenaturing polyacrylamide gel and visualized with ethidium bromide.

Gene	Allele	Fragments	Strains
D1Mcg5	a	smaller	A/J, C3H/HeJ
	b	smallest	C57BL/6J
	k	larger	AKR/J, C57L/J, DBA/2J
	s	largest	M. spretus

J:20139 Malo D, et al., Genomics. 1994 Sep 1;23(1):51-61

Gene	Allele	Fragments	Strains
D1Mcg101	a	179bp	AKR/J, BUB/BnJ, C57BR/cdJ, C57L/J, C58/J, DBA/2J, RF/J
	b	177bp	PL/J, SJL/J
	c	175bp	RIIIS/J
	d	171bp	129P3/J, LP/J
	e	169bp	CBA/J, P/J
	f	167bp	NZB/BlNJ
	g	165bp	SWR/J
	h	163bp	A/J, BALB/cJ, C3H/HeJ, C57BL/6J, C57BL/10J, CE/J, DBA/1J, SWV
	i	161bp	NZW/LacJ
	j	155bp	NOD/ShiLt
	k	121bp	M. spretus

J:12786 Malo D, et al., High-resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 1993 Jun;16(3):655-63

J:20139 Malo D, et al., Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics. 1994 Sep 1;23(1):51-61

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24