D1Mcg6-pA, D1Mcg6-pB Primer Detail MGI Mouse MGI:520

D1Mcg6-pA, D1Mcg6-pB Primer Detail

Name

D1Mcg6-pA, D1Mcg6-pB
Primer 1 Sequence

CACCCTCAAATGATTGCATG
Primer 2 Sequence

GTATCACTCAGACTCCAAATTC
ID

MGI:520
Product Size

121bp

D1Mcg136	DNA segment, Chr 1, McGill University 136
D1Mcg6	DNA segment, Chr 1, McGill University 6

J:12786 Malo D, et al., Genomics. 1993 Jun;16(3):655-63

Notes: Genomic DNA was amplified via PCR, electrophoresed on an 8-12% nondenaturing polyacrylamide gel and visualized with ethidium bromide.

Gene	Allele	Fragments	Strains
D1Mcg6	a	smaller	A/J, C3H/HeJ
	b	largest	C57BL/6J, C57L/J, DBA/2J
	k	larger	AKR/J
	s	smallest	M. spretus

J:20139 Malo D, et al., Genomics. 1994 Sep 1;23(1):51-61

Gene	Allele	Fragments	Strains
D1Mcg136	a	125bp	C57BL/6J, C57BL/10J, C57BR/cdJ, C57L/J, CE/J, DBA/1J, DBA/2J, LP/J, NZB/BlNJ, NZW/LacJ, P/J, SJL/J, SWV
	b	123bp	C58/J
	c	121bp	129P3/J, BALB/cJ
	d	119bp	AKR/J, SWR/J
	e	115bp	CBA/J, NOD/ShiLt, RF/J
	f	111bp	A/J, BUB/BnJ, C3H/HeJ, PL/J, RIIIS/J
	g	83bp	M. spretus

J:12786 Malo D, et al., High-resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 1993 Jun;16(3):655-63

J:20139 Malo D, et al., Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics. 1994 Sep 1;23(1):51-61

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13