T17 Primer Detail MGI Mouse MGI:524

T17 Primer Detail

Name

T17
Primer 1 Sequence

ACATATATGGACTACATACATAC
Primer 2 Sequence

AGACACATACAACATAGAATTGTT
ID

MGI:524
Product Size

150bp
Synonyms

TJ-T13

D1Nds2

DNA segment, Chr 1, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D1Nds2	a	largest	AKR/J
	n	smaller	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, DBA/2J, NON
	o	smallest	NOD

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D1Nds2	e	180bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
D1Nds2	a	158bp	A/J, BALB/cJ, LP/J
	c	159bp	C3H/HeJ, NOD/MrkTac
	f	167bp	CAST/EiJ
	h	190bp	AKR/J
	i	178bp	NON/ShiLt
	s	123bp	SPRET/EiJ

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24