L1 repeat element Primer Detail MGI Mouse MGI:536

L1 repeat element Primer Detail

Name

L1 repeat element
Primer 1 Sequence

GGTATGGGGGACTTTTGGGAT
Primer 2 Sequence

GGTATGGGGGACTTTTGGGAT
ID

MGI:536

D16Smh250	DNA segment, Chr 16, St. Mary's Hospital 250
D16Smh580	DNA segment, Chr 16, St. Mary's Hospital 580

J:11584 Irving NG, et al., Genomics. 1991 Nov;11(3):679-86

Notes: Using the L1 repeat element as a primer source, genomic DNAs from the indicated strains were amplified via PCR, run on a 3% agarose gel and stained with ethidium bromide. Using the L1 repeat element as a primer source, genomic DNAs from the indicated strains were amplified via PCR, run on a 3% agarose gel and subjected to Southern analysis.

Gene	Allele	Fragments	Strains
D16Smh250	b	250,180bp	C57BL/6, C57BL/10
D16Smh250	s	240,180bp	M. spretus
D16Smh580	b	580,470bp	C57BL/6
D16Smh580	s	absent	M. spretus

J:11584 Irving NG, et al., Mouse chromosome-specific markers generated by PCR and their mapping through interspecific backcrosses. Genomics. 1991 Nov;11(3):679-86

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/05/2024 MGI 6.24