About   Help   FAQ
Dsh4A, Dsh4B Primer Detail
Primers
  • Name
    Dsh4A, Dsh4B
  • Primer 1 Sequence
    AAGTTCATGGGCCTCACCACCTGTC
  • Primer 2 Sequence
    TACTAGCTACCCTTCACATACC
  • ID
    MGI:56
  • Product Size
    100-300bp
Genes
Dvl1 dishevelled segment polarity protein 1
Polymorphisms
J:2643 Beier DR, et al., Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6
Notes: Radioisotopically labeled PCR products were electrophoresed on a 5% nondenaturing polyacrylamide gel and subsequently analyzed using autoradiography.
Endonuclease Gene Allele Fragments Strains
Dvl1 a multiple AKR/J, C3H/HeJ, DBA/2J
b multiple C57BL/6J, C57L/J
s multiple M. spretus
J:4594 Eicher EM, et al., Mamm Genome. 1993;4(4):226-9
Endonuclease Gene Allele Fragments Strains
Dvl1 b smaller C57BL/6J
s larger M. spretus
References
J:2643 Beier DR, et al., Mapping genes in the mouse using single-strand conformation polymorphism analysis of recombinant inbred strains and interspecific crosses. Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6
J:4594 Eicher EM, et al., Molecular markers that define the distal ends of mouse autosomes 4, 13, and 19 and the sex chromosomes. Mamm Genome. 1993;4(4):226-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory