T21 Primer Detail MGI Mouse MGI:588

T21 Primer Detail

Name

T21
Primer 1 Sequence

ACACATTGGAGATGCACAGCG
Primer 2 Sequence

TCTGCATGCCAGGGTTGTGAT
ID

MGI:588
Product Size

130bp
Synonyms

GT3

D3Nds2

DNA segment, Chr 3, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D3Nds2	d	smaller	DBA/2J
	n	smallest	AKR/J, B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7, NOD, NON
	s	largest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D3Nds2	d	122bp	DBA/2J
	e	115bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	f	147bp	CAST/EiJ
	s	133bp	SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D3Nds2	a	smallest	AKR/J, C57BL/J
	l	largest	LG/J
	s	smaller	SM/J

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:4074 de Gouyon B, et al., Genetic analysis of diabetes and insulitis in an interspecific cross of the nonobese diabetic mouse with Mus spretus. Proc Natl Acad Sci U S A. 1993 Mar 1;90(5):1877-81

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13