F1 Primer Detail MGI Mouse MGI:598

F1 Primer Detail

Name

F1
Primer 1 Sequence

TCAGTATGTACATCCATGCC
Primer 2 Sequence

TAAAAATGATAAGTTGTTTTATGAA
ID

MGI:598

D4Wsm1	DNA segment, Chr 4, WSM 1
Ifna	interferon alpha

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Endonuclease	Gene	Allele	Fragments	Strains
	D4Wsm1	e	160bp	B6.Cg-Lep^ob/+
	D4Wsm1	f	185bp	CAST/EiJ

J:18898 Rinchik EM, et al., Genetics. 1994 Jul;137(3):845-54

Gene	Allele	Fragments	Strains
Ifna	a	160bp	101/Rl
	c	150bp	C3H/Rl
	s	170,165bp	M. spretus

J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85

Endonuclease	Gene	Allele	Fragments	Strains
	D4Wsm1	b	152bp	BKS.D-Dock7^m
	D4Wsm1	c	140bp	CZECHII

J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76

Endonuclease	Gene	Allele	Fragments	Strains
	D4Wsm1	b	smaller	C57BL/6J
	D4Wsm1	r	larger	RF/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:18898 Rinchik EM, et al., Molecular genetics of the brown (b)-locus region of mouse chromosome 4. I. Origin and molecular mapping of radiation- and chemical-induced lethal brown deletions. Genetics. 1994 Jul;137(3):845-54

J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24